ID: 1090473057

View in Genome Browser
Species Human (GRCh38)
Location 11:126997023-126997045
Sequence CTGATCTCCACCTCGGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 101}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090473057_1090473065 15 Left 1090473057 11:126997023-126997045 CCTGTCTCCGAGGTGGAGATCAG 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1090473065 11:126997061-126997083 CAGGGAGTCATCAGTCCTCTAGG 0: 1
1: 0
2: 0
3: 22
4: 164
1090473057_1090473060 -8 Left 1090473057 11:126997023-126997045 CCTGTCTCCGAGGTGGAGATCAG 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1090473060 11:126997038-126997060 GAGATCAGAGATCTCCCTGGAGG 0: 1
1: 0
2: 0
3: 7
4: 170
1090473057_1090473061 -4 Left 1090473057 11:126997023-126997045 CCTGTCTCCGAGGTGGAGATCAG 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1090473061 11:126997042-126997064 TCAGAGATCTCCCTGGAGGCAGG 0: 1
1: 0
2: 1
3: 24
4: 289
1090473057_1090473062 -3 Left 1090473057 11:126997023-126997045 CCTGTCTCCGAGGTGGAGATCAG 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1090473062 11:126997043-126997065 CAGAGATCTCCCTGGAGGCAGGG 0: 1
1: 0
2: 3
3: 37
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090473057 Original CRISPR CTGATCTCCACCTCGGAGAC AGG (reversed) Intronic
901245028 1:7723504-7723526 CTAAGTTCCACCTCGCAGACGGG - Intronic
902778664 1:18690699-18690721 CTAATTTCCACCATGGAGACTGG - Intronic
903161971 1:21495497-21495519 CTGACCTCCCCCTAGGAGAGAGG - Intergenic
903480716 1:23651370-23651392 CTGATCTCCTCTTGGTAGACAGG + Intergenic
904004628 1:27357284-27357306 CTGATCTTCACAGAGGAGACAGG + Intronic
910100926 1:83575721-83575743 CTGCTCTCCACCTCAGGTACTGG + Intergenic
918702139 1:187618299-187618321 CTAATCTTCATCTCAGAGACTGG + Intergenic
922454244 1:225762046-225762068 CTTTTCTGCACCTGGGAGACAGG + Intergenic
922964147 1:229674064-229674086 CTGATCCTCTCCTCTGAGACAGG + Intergenic
1063178883 10:3578269-3578291 CTGAGCTCAACCTCAGAAACAGG + Intergenic
1066480887 10:35794733-35794755 CAGCTCTCCTCCTCGGAGCCTGG + Intergenic
1067897458 10:50199727-50199749 CTGATCCTCACATGGGAGACTGG - Intronic
1067951515 10:50742312-50742334 CTGATCCTCACATGGGAGACTGG + Intronic
1070037864 10:72744801-72744823 ATGATCTCCAACTCAGAAACAGG - Intronic
1070683834 10:78467546-78467568 CTAACCTCCACCTCTGTGACTGG - Intergenic
1073148034 10:101293051-101293073 GAGATCTCCTCCTCGGAGAGGGG - Intergenic
1074633086 10:115280704-115280726 ATGGTCTACACCCCGGAGACTGG - Intronic
1082170467 11:48998074-48998096 ATGATATCCACCACCGAGACAGG + Intergenic
1083475086 11:62910193-62910215 TTGATCACCACTTCGGAGCCAGG + Exonic
1088042998 11:105411297-105411319 CTCCTCACCACCTCGGTGACCGG - Intergenic
1088278167 11:108111027-108111049 GTGATCTCTTCCTCTGAGACAGG - Intergenic
1090473057 11:126997023-126997045 CTGATCTCCACCTCGGAGACAGG - Intronic
1091305165 11:134531892-134531914 CTGAGCCCCTCCTCGGTGACCGG + Intergenic
1099931203 12:89076991-89077013 CTGAGCTCCACCCAGTAGACTGG - Intergenic
1100048247 12:90411266-90411288 CTGAACCCCACCTCCCAGACTGG - Intergenic
1115508215 14:34112782-34112804 CAGATCTCCACCTGGAAGAGAGG - Intronic
1122969132 14:105145348-105145370 CTGAGCCCCTCCTGGGAGACAGG + Intronic
1126242824 15:46465363-46465385 CTGCACTCCACCTTGGCGACAGG + Intergenic
1127108647 15:55644664-55644686 ATGATTTCCACATAGGAGACGGG - Intronic
1127163490 15:56217883-56217905 TAGTTCTCCACCTGGGAGACTGG + Intronic
1132658495 16:1051328-1051350 CTGATCCCGACGTCTGAGACTGG + Intergenic
1138558498 16:57786639-57786661 CTGCCCTCCACCTCGGAGCCTGG + Intronic
1143952722 17:10646420-10646442 CTGGTCTCCAGCTTGGAAACAGG - Intronic
1151111256 17:71680708-71680730 CACATCTCCACCTTGGAGTCTGG - Intergenic
1151619688 17:75238242-75238264 GTGATCTCCACCTTGAAGCCAGG - Exonic
1152867300 17:82732003-82732025 CTGCACTCCAACTTGGAGACAGG + Intergenic
1153350612 18:4077410-4077432 CTGAGCACCACCTCTGACACTGG - Intronic
1157333434 18:46720224-46720246 CTGCTCACCACCTGGGAGGCAGG + Intronic
1157726071 18:49965011-49965033 CTGACCTGCACCTTAGAGACCGG + Intronic
1161114201 19:2487915-2487937 GTGATCTCCACCTCGTGGTCGGG + Intergenic
1165215060 19:34265218-34265240 CATATATCCACCTCGGGGACCGG - Intronic
1166874792 19:45890822-45890844 GTGATCTCCACCTTGGGGGCCGG + Exonic
925142095 2:1557702-1557724 CTGACCTCCACCCTGCAGACGGG + Intergenic
926670456 2:15572740-15572762 CTGGGCTCCACCTCGGACAGGGG + Intergenic
928401241 2:30980182-30980204 CTGCTCTCCAGCTCTGAGTCAGG - Intronic
928440807 2:31290399-31290421 CTGATCTCCACCTCTCAGAGTGG + Intergenic
936561001 2:113539802-113539824 CTGCACTCCACCTGGGTGACAGG + Intergenic
941666474 2:168247701-168247723 CTGTTCTCCGCCTCGGCGAGGGG + Exonic
942523401 2:176828579-176828601 CTCATCTGCACCTGGGAGGCAGG + Intergenic
945984423 2:216342397-216342419 CTTCTCTCCTCCTTGGAGACAGG - Intronic
948986941 2:241531524-241531546 CTGATCTCCAGCTCCTGGACTGG + Intergenic
1169132267 20:3172556-3172578 CTGATCTCCACCCCCCAGAGGGG + Intronic
1174456427 20:50651995-50652017 TTGAACTCCCCCTCGGAGTCTGG + Intronic
1175893633 20:62326568-62326590 CTGTTTTCCACCACGGAGAATGG + Intronic
1178901594 21:36603347-36603369 CTGCTCTTCACCTCAGAGAAAGG - Intergenic
1180871872 22:19150841-19150863 CTGCCCGCCACCTCGGAGCCAGG + Intergenic
1181529761 22:23510740-23510762 CTGAGCTCCACCCGGGAGTCAGG + Intergenic
1182961551 22:34480112-34480134 CTCATCCCCACCTGGGAAACAGG - Intergenic
950522560 3:13505544-13505566 CTGATTTCCACCTGTGAGCCTGG - Exonic
950536235 3:13580569-13580591 CTGCTCCCCACCTCTCAGACTGG - Intronic
952888318 3:38025049-38025071 CTGAGCTCCGCCTCTGAGCCTGG - Intronic
954405142 3:50341290-50341312 CTGCTCTCCACTGCGGAGACTGG + Exonic
955324571 3:58000292-58000314 CTGATCTCCACCTTGGCTGCTGG + Intergenic
956013614 3:64857977-64857999 CAAATCTCCACCTCAGAGCCAGG + Intergenic
958466581 3:94467347-94467369 TTGATCTCCACTTAGGAGAATGG + Intergenic
962011309 3:131393665-131393687 CTCATTTTCACCTCGGAGGCAGG + Intergenic
963164314 3:142185195-142185217 CTGATCTCGAACTCCTAGACTGG - Intronic
967808602 3:193736561-193736583 CTGATCTCCCCCATGGAGCCAGG - Intergenic
969337571 4:6520658-6520680 CTCACCTCCACTTTGGAGACAGG + Intronic
975695323 4:77007277-77007299 CTGTTCTCCATCTCTCAGACTGG + Intronic
981044758 4:140254425-140254447 CTGAGCGCCACCTCTGATACTGG + Intergenic
985763910 5:1766623-1766645 TTCATCTCCACCTTGGAGGCGGG - Intergenic
989775265 5:45198950-45198972 CTGCTCTCCAGCTTGGCGACGGG + Intergenic
995480364 5:112586616-112586638 CTGAGCTCGACCTGGGACACTGG + Intergenic
1001064601 5:168526365-168526387 CTGATCTCCACCCCAGTGACAGG - Intergenic
1002418412 5:179132742-179132764 CTGCTCTCCACCCTGGAGCCTGG - Intronic
1005672840 6:28124688-28124710 CTTTTCTCCACCTGGGAGCCGGG - Intronic
1006814095 6:36839295-36839317 GTGATCTCCACCTTGGTGGCCGG + Exonic
1006837123 6:37005791-37005813 CTGAGATCCACCCCGGAAACCGG + Exonic
1007663834 6:43502918-43502940 CTGATCTCCAGTTCAGGGACTGG - Intronic
1008553170 6:52652696-52652718 CTGATCTCCACTCCCCAGACTGG - Intergenic
1011559770 6:88602704-88602726 TTGTTCTCCACCATGGAGACTGG - Intergenic
1012741483 6:103021299-103021321 CTGCACTCCAGCTGGGAGACAGG - Intergenic
1015718166 6:136213371-136213393 CTGTCCTCCACTTGGGAGACTGG - Intergenic
1016563421 6:145423802-145423824 TTAATCTCCACTTGGGAGACTGG - Intergenic
1019055765 6:169222246-169222268 GTGAACTCCACCACGGGGACGGG - Exonic
1019157126 6:170046585-170046607 CTGGTCTCCACCTCGGAACGTGG + Intergenic
1029935395 7:104419621-104419643 TTGATTTCCACCTCGAAAACCGG - Intronic
1033163824 7:139020907-139020929 CAGGACTCCACCTCGGAGGCAGG + Intergenic
1037769429 8:21789825-21789847 CTGACCACCTCCTCGGAGGCCGG + Intronic
1039832154 8:41223884-41223906 CTGGTCGCCACCTCTGAGGCTGG + Intergenic
1040066355 8:43147835-43147857 GTGCTCACCACCTGGGAGACAGG + Intronic
1047738094 8:127784214-127784236 CTGGTCTCCAACCTGGAGACAGG + Intergenic
1049061237 8:140277788-140277810 CTCATCTCCTCCTAGGAGACTGG - Intronic
1049665248 8:143840128-143840150 ACGAGCTCCACTTCGGAGACAGG - Exonic
1049891679 9:75524-75546 CTGCACTCCACCTGGGTGACAGG - Intergenic
1050096244 9:2069875-2069897 ATGATCTCCACCTGGGTGACAGG - Intronic
1053733106 9:41076615-41076637 CTGCACTCCACCTGGGTGACAGG - Intergenic
1054695316 9:68354948-68354970 CTGCACTCCACCTGGGTGACAGG + Intronic
1055794798 9:79964312-79964334 TTGGTCTCCACCTCGCATACTGG - Intergenic
1058045277 9:100351926-100351948 GTGAGCTCCTCCTCTGAGACTGG - Intronic
1061428983 9:130519281-130519303 TTGATTTCCAGATCGGAGACGGG - Intergenic
1187259923 X:17676012-17676034 CTAACCTCCACCTAGGAGAAGGG + Intronic
1192189279 X:68980938-68980960 CTGATCCCCTCCTCAGAGATAGG + Intergenic
1198714395 X:139541064-139541086 CTGATCTCCATCTTTGAGATAGG - Exonic
1199592888 X:149484351-149484373 CTGAACTCCATCCTGGAGACAGG - Intronic
1200012829 X:153132862-153132884 CTGCTCTCCAGGTCGGAGAGCGG - Intergenic
1200026772 X:153267055-153267077 CTGCTCTCCAGGTCGGAGAGCGG + Intergenic