ID: 1090475328

View in Genome Browser
Species Human (GRCh38)
Location 11:127015006-127015028
Sequence CTGTTAGTAAGGATGAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090475328_1090475332 4 Left 1090475328 11:127015006-127015028 CCCAGCTTCATCCTTACTAACAG No data
Right 1090475332 11:127015033-127015055 CCATCCATGTTCTTTCAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090475328 Original CRISPR CTGTTAGTAAGGATGAAGCT GGG (reversed) Intergenic
No off target data available for this crispr