ID: 1090479614

View in Genome Browser
Species Human (GRCh38)
Location 11:127056536-127056558
Sequence AATGCTGACTGTGCCTCCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090479614_1090479616 13 Left 1090479614 11:127056536-127056558 CCGGGGGAGGCACAGTCAGCATT No data
Right 1090479616 11:127056572-127056594 TTGGCTAGAATTCAGTCACATGG No data
1090479614_1090479617 22 Left 1090479614 11:127056536-127056558 CCGGGGGAGGCACAGTCAGCATT No data
Right 1090479617 11:127056581-127056603 ATTCAGTCACATGGCCACAGAGG No data
1090479614_1090479619 29 Left 1090479614 11:127056536-127056558 CCGGGGGAGGCACAGTCAGCATT No data
Right 1090479619 11:127056588-127056610 CACATGGCCACAGAGGGCGCTGG No data
1090479614_1090479620 30 Left 1090479614 11:127056536-127056558 CCGGGGGAGGCACAGTCAGCATT No data
Right 1090479620 11:127056589-127056611 ACATGGCCACAGAGGGCGCTGGG No data
1090479614_1090479615 -6 Left 1090479614 11:127056536-127056558 CCGGGGGAGGCACAGTCAGCATT No data
Right 1090479615 11:127056553-127056575 AGCATTCACTGAGATTTCATTGG No data
1090479614_1090479618 23 Left 1090479614 11:127056536-127056558 CCGGGGGAGGCACAGTCAGCATT No data
Right 1090479618 11:127056582-127056604 TTCAGTCACATGGCCACAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090479614 Original CRISPR AATGCTGACTGTGCCTCCCC CGG (reversed) Intergenic
No off target data available for this crispr