ID: 1090479620

View in Genome Browser
Species Human (GRCh38)
Location 11:127056589-127056611
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090479614_1090479620 30 Left 1090479614 11:127056536-127056558 CCGGGGGAGGCACAGTCAGCATT No data
Right 1090479620 11:127056589-127056611 ACATGGCCACAGAGGGCGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090479620 Original CRISPR ACATGGCCACAGAGGGCGCT GGG Intergenic
No off target data available for this crispr