ID: 1090480034

View in Genome Browser
Species Human (GRCh38)
Location 11:127059869-127059891
Sequence CAGAGGAAGGAGCAGGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090480027_1090480034 -4 Left 1090480027 11:127059850-127059872 CCCATGACTCAGCTAGGGACAGA No data
Right 1090480034 11:127059869-127059891 CAGAGGAAGGAGCAGGGGACAGG No data
1090480023_1090480034 2 Left 1090480023 11:127059844-127059866 CCCAGTCCCATGACTCAGCTAGG No data
Right 1090480034 11:127059869-127059891 CAGAGGAAGGAGCAGGGGACAGG No data
1090480025_1090480034 1 Left 1090480025 11:127059845-127059867 CCAGTCCCATGACTCAGCTAGGG No data
Right 1090480034 11:127059869-127059891 CAGAGGAAGGAGCAGGGGACAGG No data
1090480022_1090480034 3 Left 1090480022 11:127059843-127059865 CCCCAGTCCCATGACTCAGCTAG No data
Right 1090480034 11:127059869-127059891 CAGAGGAAGGAGCAGGGGACAGG No data
1090480028_1090480034 -5 Left 1090480028 11:127059851-127059873 CCATGACTCAGCTAGGGACAGAG No data
Right 1090480034 11:127059869-127059891 CAGAGGAAGGAGCAGGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090480034 Original CRISPR CAGAGGAAGGAGCAGGGGAC AGG Intergenic
No off target data available for this crispr