ID: 1090480277

View in Genome Browser
Species Human (GRCh38)
Location 11:127061760-127061782
Sequence CAAAGAAAGGAGAAGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090480277_1090480287 24 Left 1090480277 11:127061760-127061782 CCTTCCCCCTTCTCCTTTCTTTG No data
Right 1090480287 11:127061807-127061829 TCTCCTGTATTCTTCCTTGCAGG No data
1090480277_1090480284 -3 Left 1090480277 11:127061760-127061782 CCTTCCCCCTTCTCCTTTCTTTG No data
Right 1090480284 11:127061780-127061802 TTGCGAGGCCAAAGAGAAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090480277 Original CRISPR CAAAGAAAGGAGAAGGGGGA AGG (reversed) Intergenic
No off target data available for this crispr