ID: 1090482058

View in Genome Browser
Species Human (GRCh38)
Location 11:127077651-127077673
Sequence CGAGTCTGTCCCCACAAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090482058_1090482062 5 Left 1090482058 11:127077651-127077673 CCCAACTTGTGGGGACAGACTCG No data
Right 1090482062 11:127077679-127077701 ACCCAGGTTCATGTCATTCCTGG No data
1090482058_1090482066 26 Left 1090482058 11:127077651-127077673 CCCAACTTGTGGGGACAGACTCG No data
Right 1090482066 11:127077700-127077722 GGCTGCCCTCCCATCTTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090482058 Original CRISPR CGAGTCTGTCCCCACAAGTT GGG (reversed) Intergenic