ID: 1090484502

View in Genome Browser
Species Human (GRCh38)
Location 11:127100797-127100819
Sequence ATGTAGGCTCAGTGTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 228}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090484502 Original CRISPR ATGTAGGCTCAGTGTGAGGA AGG Intergenic
900704369 1:4070702-4070724 ATGTAGAATCAGAGAGAGGAAGG + Intergenic
900804190 1:4756596-4756618 ATGTAGTCTCAGAGACAGGAGGG - Intronic
902154562 1:14474058-14474080 ATGTAAGCTCAGTGAGATCAGGG + Intergenic
902374056 1:16022011-16022033 AAGGAGGCTCTGTGAGAGGAGGG + Intronic
902378982 1:16043828-16043850 CTGGAGGCTCTGTGAGAGGAGGG + Exonic
903280895 1:22249247-22249269 ACGCAGGCTCTGTGGGAGGAAGG + Intergenic
904064512 1:27738673-27738695 ATGTAAGCTCTGTGAGAGTAAGG - Intronic
904369440 1:30039227-30039249 AGGTGGGCCCTGTGTGAGGAAGG - Intergenic
905350576 1:37343632-37343654 ATGGAAGCTCAGAGAGAGGAAGG + Intergenic
905618833 1:39422694-39422716 ATGTAGGTTCATTATGAGAACGG - Intronic
906292378 1:44627701-44627723 AGGGAGGCCCAGTGTGAGAAGGG + Intronic
906789516 1:48646267-48646289 AAGGAGGCTCAGAGTGATGACGG + Intronic
906992113 1:50750525-50750547 AAGGAGGATCAGTGTGAGTAGGG - Intronic
907629842 1:56069478-56069500 ATGGAGGGTGAGTGTGGGGAAGG + Intergenic
907651207 1:56296424-56296446 ATTGAGGCTCAGATTGAGGAAGG - Intergenic
907734192 1:57095688-57095710 ATGGAGGCTAGGTGTGAGGAGGG + Intronic
909943398 1:81635955-81635977 ATATGTGCTGAGTGTGAGGACGG - Intronic
910450894 1:87343744-87343766 GTGGAAGCTCAGTGTGAGAAAGG - Intronic
911010136 1:93272233-93272255 ATGTAAGCTCTGTGTGGAGAGGG + Intronic
913152895 1:116063237-116063259 ATGTAGGCTCTGTGAGAATAGGG - Intronic
913206861 1:116546888-116546910 AAGCAGGCTAAGTGGGAGGAGGG - Intronic
914901672 1:151714505-151714527 AATTATGCTCAGTGTCAGGAGGG + Intronic
919046867 1:192463570-192463592 ATGTAGTCTTAGTGAGAGGGAGG - Intergenic
921717850 1:218436683-218436705 ATGTGGTCTCAGTAAGAGGAGGG + Intronic
1063165222 10:3455507-3455529 ATGGAGTCTCCGTGTGAGGTTGG - Intergenic
1063278401 10:4597188-4597210 ATGCAGGAGCAGGGTGAGGAGGG - Intergenic
1064287138 10:14001525-14001547 TTATTGGCTCAGTGTGGGGAAGG - Intronic
1064889970 10:20160037-20160059 ATGTAGGCTCTGTGAGAGAAGGG + Intronic
1067687985 10:48479243-48479265 ATTGAAGCTCAGTGAGAGGACGG - Intronic
1067950568 10:50733273-50733295 AGGGAGGCTCATTTTGAGGATGG - Intergenic
1069557341 10:69406921-69406943 CTGGGGGCTGAGTGTGAGGACGG + Intronic
1069751575 10:70748527-70748549 ATGTAGGGGCAGGGTGAGGGTGG - Intronic
1071988067 10:91072783-91072805 ATGTAGGCTGCCTGAGAGGAGGG + Intergenic
1072598767 10:96902669-96902691 ATGAAGGCTCAGTGTGGTGGTGG + Intronic
1075583243 10:123638121-123638143 ATGAGGGCTCAGTGTGAGGAAGG - Intergenic
1076329556 10:129654487-129654509 ATGCAGGCTCAGAGTGAGCAGGG - Intronic
1077916554 11:6615397-6615419 ATGCAGGGTAAGAGTGAGGATGG - Intronic
1078687848 11:13549651-13549673 AGGTAGGCTCAGGTTTAGGAGGG + Intergenic
1082312658 11:50672199-50672221 ATGGAGGCCCATTGTGAGAAAGG - Intergenic
1082312766 11:50673716-50673738 ATGGAGGCCCATTGTGAGAAAGG - Intergenic
1083805196 11:65069345-65069367 AGGTGGACTCAGTGTGAAGAAGG - Intronic
1084350555 11:68595898-68595920 GTGGAGGCTTAGTGTGAGGTTGG + Intronic
1084475520 11:69386516-69386538 ATGGAGGCTCAGAGAGAGAATGG - Intergenic
1085455375 11:76662451-76662473 ATCTAGGCTCAGGGAGGGGAAGG + Intronic
1086290722 11:85306330-85306352 ATGTAAGCTCTGTGAGAGAAAGG - Intronic
1086575921 11:88338728-88338750 TAGTAGGCTCAGTGGGAGAAAGG - Intergenic
1086815906 11:91370393-91370415 ATGTGGGCCCAGAATGAGGAGGG + Intergenic
1089384637 11:118059751-118059773 ATCTGGGCTCAGAGTGAGGCAGG - Intergenic
1089539628 11:119182046-119182068 ATGAGGGCTCATTGAGAGGAGGG - Intronic
1090484502 11:127100797-127100819 ATGTAGGCTCAGTGTGAGGAAGG + Intergenic
1090625464 11:128604380-128604402 AAGTAGGCACCGTGTGGGGAGGG - Intergenic
1091382578 12:71878-71900 ATGAAGGCTCACTGGGAGAAGGG + Intronic
1092670095 12:10852992-10853014 ATGTAGGTTCAGTTTGGAGATGG - Intronic
1092950654 12:13500039-13500061 ATGGAAGCTCAGTCTGTGGAAGG + Intergenic
1093554491 12:20454435-20454457 ACGTAAGCTCAGTAAGAGGAGGG + Intronic
1093865696 12:24224860-24224882 ATGTAGCCTCTGTGTGGGTAAGG - Intergenic
1094407954 12:30138445-30138467 ATTTAGCCTCAGTCTTAGGAAGG - Intergenic
1094412300 12:30179416-30179438 ATGTAGGGACAGTGTGGGGGAGG - Intergenic
1096799966 12:54103967-54103989 AACTAGGATCAGTGAGAGGAGGG + Intergenic
1097268985 12:57762697-57762719 ATGTAAGCTCTTTGAGAGGAAGG - Exonic
1097424444 12:59425293-59425315 ATGTAAGCTCACTGAGAGCAGGG - Intergenic
1097718790 12:62998280-62998302 ATGTAGGTTCCATGTGAGTAGGG - Intergenic
1097985116 12:65774967-65774989 TTGTAAGCTCAGTGTGGGGAGGG - Intergenic
1099322204 12:81164301-81164323 ATATAGCCTCAGTGTGTGGTAGG + Intronic
1101142468 12:101810642-101810664 ATGTAGGCTCTGTGGGAGCAGGG - Intronic
1102020320 12:109677790-109677812 ATGTGAGCTCAGTGTGAAGGGGG + Intergenic
1102123169 12:110458978-110459000 CTGGAGGCTGAGGGTGAGGAAGG - Intronic
1102205790 12:111089976-111089998 AGGTGGGCTTAATGTGAGGAAGG + Intronic
1102357525 12:112251615-112251637 ATGTAAGCTCCGTGAGAGCAGGG - Intronic
1103599149 12:122043321-122043343 CAGTTGGCTCAGTGTGGGGAAGG + Intronic
1104939476 12:132388136-132388158 ATGCAGGCTCAGAGAGGGGAGGG + Intergenic
1105293871 13:19071691-19071713 ATGTAGGATCAGTGCCAGCAGGG - Intergenic
1106214339 13:27681320-27681342 ATGCAGTCTCAGTGTGAGAAAGG + Intergenic
1106926254 13:34616121-34616143 AAGTAGGCTGAGGGTGAGGTGGG - Intergenic
1107153788 13:37142687-37142709 ATCTAGGCTTAATGTGAGCATGG + Intergenic
1108180676 13:47836971-47836993 ATGTAGGGTCAATGGGTGGATGG - Intergenic
1108622980 13:52202037-52202059 ATGTAAGCTCAGTGAGAGCAGGG + Intergenic
1108663748 13:52609006-52609028 ATGTAAGCTCAGTGAGAGTAGGG - Intergenic
1112730455 13:102354624-102354646 TTGTAGGCAAATTGTGAGGAAGG + Intronic
1118445007 14:65842834-65842856 ATGGAGGCTCAGTGTGGTTAAGG + Intergenic
1119205928 14:72793543-72793565 ATGGAGGTAGAGTGTGAGGATGG - Intronic
1119457752 14:74770698-74770720 CTGAAAGCTCAGGGTGAGGATGG + Intronic
1120034517 14:79681235-79681257 ATGAAGGCTCAGCAGGAGGAGGG - Intronic
1120156401 14:81098144-81098166 ATGTACGCTCAGTGTGGGCAGGG - Intronic
1121002773 14:90464191-90464213 AATTAGGCTCTTTGTGAGGATGG - Intergenic
1121039483 14:90733532-90733554 TTGGAGGCTCTTTGTGAGGAAGG - Intronic
1122052973 14:99072777-99072799 AGGAAGGCTCAGTGTCGGGAAGG + Intergenic
1122362200 14:101174185-101174207 ATGGAGGCCCAGGGTGGGGATGG - Intergenic
1122889867 14:104727277-104727299 ATGTAGGCTCAGCCTGGAGAAGG - Intronic
1125715520 15:41817745-41817767 ATGTGGGCAGAGTCTGAGGAGGG - Intronic
1126070268 15:44859854-44859876 ACCTAGGCTCAGTTTGAGAATGG - Intergenic
1126087769 15:45025250-45025272 ACCTAGGCTCAGTTTGAGAATGG + Intronic
1126499755 15:49332404-49332426 CTGTAAGCTCATTGTGAGCAGGG + Intronic
1127701346 15:61504520-61504542 ATCTCAGCTCAGTGTGGGGAGGG - Intergenic
1128241072 15:66101330-66101352 TTGAAGGCCCAGTGTGGGGAGGG - Intronic
1128361915 15:66968138-66968160 ATGGAGGTTTAGAGTGAGGATGG + Intergenic
1128562570 15:68678331-68678353 CTGGGGGCTCAGTGTGAGGGAGG - Intronic
1129686161 15:77687223-77687245 ATCAGGGCTCAGTGTGAGGCTGG + Intronic
1131182780 15:90251782-90251804 AGGTAGTCTCAGTGTTAGGGAGG + Intronic
1133077446 16:3290672-3290694 ATGGGGGCTCATTGTGAGGGAGG + Exonic
1133274199 16:4626779-4626801 ATGGATGCTCAGTGGGAGGGAGG - Intronic
1134133763 16:11667005-11667027 ATATAGGCTGAGTGGGACGATGG + Intergenic
1136051052 16:27650278-27650300 ATGCAGGCACAGTGTGAACAAGG + Intronic
1138611409 16:58128436-58128458 ATTTGGGATCAGTGGGAGGAAGG + Intronic
1140280521 16:73550410-73550432 CAGTAGGCCCAGTGTGAGGCTGG + Intergenic
1141177025 16:81727666-81727688 ATGTGGCCTGAGGGTGAGGATGG - Intergenic
1141577518 16:84973788-84973810 ATGTAGGCTCATTGTATAGAAGG - Intergenic
1142058368 16:88014681-88014703 ATGCAGGACCAGTGCGAGGATGG - Intronic
1143393018 17:6571291-6571313 ATATCTGCTCAGTGTGATGAAGG - Intergenic
1143542947 17:7580373-7580395 ATATAGGCTCAGAGGGAAGAAGG + Intronic
1144199329 17:12925256-12925278 CAGTTGGGTCAGTGTGAGGAAGG + Intronic
1145839860 17:27985208-27985230 AGGAAGGATCAGTGTGAGGAGGG + Intergenic
1148142965 17:45341403-45341425 ATTTAGGCTTAGGGTGAAGAAGG + Intergenic
1149848578 17:60021781-60021803 AGGCAGCCTCAGGGTGAGGAAGG + Intergenic
1149861591 17:60124743-60124765 AGGCAGCCTCAGGGTGAGGAAGG - Intergenic
1152555732 17:81052315-81052337 ATGTTGGCTCTGTGCGAGCAGGG + Intronic
1156011662 18:32503670-32503692 ACGTAGGCTCAGTTTATGGATGG + Intergenic
1157409146 18:47449215-47449237 AGGTAGGCCAAGTGGGAGGAAGG - Intergenic
1159639173 18:70843314-70843336 ATGTAGGGTCAGTATGTAGAAGG - Intergenic
1160298583 18:77658746-77658768 AGGAAGGCCCAGTGTGAGGAGGG + Intergenic
1160702390 19:514150-514172 ATGTAGGGTCAGTGTGCAGTGGG - Intronic
1160923225 19:1530191-1530213 GTGGAGGCTCAGGGAGAGGAGGG - Intronic
1162365235 19:10244583-10244605 CAGGAGGCTGAGTGTGAGGATGG + Intergenic
1162762346 19:12896239-12896261 GTGTGGGCTCGGTGTGAAGATGG + Exonic
1168479450 19:56706787-56706809 ATGAAGACTCAGGGTGTGGAGGG - Intergenic
931374436 2:61694909-61694931 ATGTAGGCTGTGGGAGAGGAAGG - Intergenic
933139521 2:78776911-78776933 ATGTAGGCTCAGCTAGAGGGAGG + Intergenic
936613172 2:114021513-114021535 ATGTAGGCTCAATTTCAGTAGGG - Intergenic
938053492 2:128196069-128196091 ATGTAGTCTCTGTGTGATGATGG + Intergenic
938636142 2:133228412-133228434 ATGTAGGCTCAATGTTAGTAAGG - Intronic
938724191 2:134092307-134092329 ATGAAGGCACTGGGTGAGGAGGG - Intergenic
938985547 2:136571912-136571934 ATTGAGGCTCAGGGAGAGGAAGG + Intergenic
939534454 2:143409801-143409823 ATGTAGCCTAAGTGTGTGGTAGG + Intronic
940628067 2:156201546-156201568 ATGTAGGCTAAGTCTAAAGAGGG - Intergenic
941084017 2:161095488-161095510 ATATAGGCTAAATGTGAGGATGG - Intergenic
944904242 2:204246410-204246432 ATGAAGGCTCAGTCTGAGTCAGG - Intergenic
946247073 2:218393986-218394008 AAGTAGGCTCAGTGTGGTTAGGG + Intronic
947746286 2:232508876-232508898 ATGGAGGCTCAGAGAGAAGAGGG - Intergenic
948187804 2:236035037-236035059 CTGCAGGCGCATTGTGAGGAAGG + Intronic
948502931 2:238408165-238408187 ATTTTGGCTCTGTGTAAGGAGGG + Intergenic
1168776230 20:449784-449806 ATGTTGTTTCAGAGTGAGGAGGG - Intronic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1171796480 20:29570375-29570397 AACTAGGATCAGTGAGAGGAGGG - Intergenic
1171851763 20:30313794-30313816 AACTAGGATCAGTGAGAGGAGGG + Intergenic
1171878465 20:30599086-30599108 ATGTAGGATCAGTGCCAGCAGGG - Intergenic
1173331620 20:42080296-42080318 ATGCAGGTTAGGTGTGAGGATGG + Exonic
1173404770 20:42754961-42754983 ATCTAAGCTCTGTGAGAGGAGGG - Intronic
1173532437 20:43780717-43780739 ATGGAGGCTCAGAGAGATGATGG - Intergenic
1173534525 20:43799432-43799454 AGCTAGGCTGGGTGTGAGGATGG + Intergenic
1175362574 20:58425216-58425238 ATGCAGGCTTTGTGAGAGGACGG + Intronic
1175884267 20:62279972-62279994 ATTTAGGCTGAGAGTGAAGAGGG - Intronic
1176282625 20:64322957-64322979 ATGAAGGCTCACTGGGAGAAGGG - Intergenic
1177107073 21:16970518-16970540 ATGTAGACTCAGTGTGAGACAGG - Intergenic
1177752907 21:25308262-25308284 TTGTAGGTTCAGTGTCTGGAAGG - Intergenic
1179028713 21:37701595-37701617 ATGTAAGCTCTGTGAGAGCAAGG - Intronic
1179086393 21:38221566-38221588 ATGTAGGCTCAGTGATAGAAAGG + Intronic
1179878880 21:44285361-44285383 ATGGAGGCTCAGTCTGATGCAGG - Intergenic
1181536796 22:23550457-23550479 ATGAAGGATAAGTGGGAGGATGG - Intergenic
1182820795 22:33214456-33214478 ATGTTTGGTCAGTGTGAGAAAGG + Intronic
1183343878 22:37296324-37296346 ATGGAGGCCCAGAGTGGGGAAGG - Intronic
1183647837 22:39136772-39136794 CTGTAGGCTTAGTATGTGGATGG + Intronic
1184971678 22:48026780-48026802 ATGTATGCTCAGTTTAAAGATGG - Intergenic
949474722 3:4432503-4432525 ATGTAGGGTCAGGGTTAGGTTGG - Intronic
951459501 3:22934731-22934753 ATATGGGCTCAATGTGAGCATGG - Intergenic
951727659 3:25777766-25777788 ATGTAAGCTCTATGTGAGGTGGG + Intronic
952201429 3:31132331-31132353 CTGTTACCTCAGTGTGAGGATGG + Intergenic
952272675 3:31848018-31848040 AGGTAGGCTCAGCCTGAGGGAGG - Intronic
953128499 3:40114327-40114349 ATGTAGCCTAAGTGTGAGGTAGG + Intronic
956791064 3:72680479-72680501 ATGTACTCACAGTGGGAGGATGG - Intergenic
959027584 3:101258083-101258105 AAGTAGGCTCATAGTGAAGAGGG - Intronic
961169414 3:124785882-124785904 ATGTAGGCTAAGTGCCAGGGTGG + Intronic
962362555 3:134754410-134754432 ATGGCTGCCCAGTGTGAGGAGGG + Intronic
965351307 3:167614803-167614825 TTTTCGTCTCAGTGTGAGGAGGG - Intronic
967155671 3:186689856-186689878 ATGGGGGCTCAGTGGAAGGAAGG - Intergenic
968497925 4:928624-928646 AGGTGGGCTCAGTGGCAGGAAGG - Intronic
968852319 4:3091405-3091427 ATGTAATCTTAGTTTGAGGAAGG + Intronic
970153014 4:13109822-13109844 ATGTCAACTCAGTGTGAAGAGGG + Intergenic
972982317 4:44720937-44720959 AGGTAGGCTGAGTGTAATGAAGG + Intronic
973695404 4:53485779-53485801 ATGTGGTGTGAGTGTGAGGAGGG + Intronic
974232818 4:59138586-59138608 TTGTAGGCTCAATGTGAGCTAGG + Intergenic
974270674 4:59647183-59647205 CTGTAGCCTCAGGGTGAGGTGGG + Intergenic
979267566 4:118721051-118721073 ATGAAGGCTCAGAGTGGAGAGGG - Intergenic
981281997 4:142969188-142969210 CTGTAGGCAAATTGTGAGGAGGG + Intergenic
981452172 4:144911255-144911277 CTGTCAGCTCAGAGTGAGGATGG + Intergenic
981940908 4:150280720-150280742 ATATGGGCTCAGATTGAGGAAGG + Intronic
986136619 5:4985798-4985820 ATGTGGGATGAGTCTGAGGAGGG + Intergenic
986637009 5:9833238-9833260 TTGTAGGCAAATTGTGAGGAAGG + Intergenic
991710603 5:69404833-69404855 TTGGAGGCTGAGTGGGAGGATGG + Intronic
991921186 5:71658499-71658521 ATGTAAGCTCCGTGAGAGCAAGG + Exonic
994012840 5:94926905-94926927 ATGTAATCTCAGTGAGAGGATGG - Intronic
994977248 5:106825445-106825467 ATGTGGGCTGAGTGTCAGCAGGG - Intergenic
1000337242 5:160250945-160250967 ATGGAGGCTCAGAGAGAGGTTGG + Intergenic
1001128117 5:169039132-169039154 TTGTAGACCCAGTTTGAGGATGG + Intronic
1001427018 5:171629392-171629414 ATGGAGGCTCAGAGAGAGGGAGG + Intergenic
1003740174 6:8927914-8927936 ATGTAAGCTCTGTGAGAAGACGG - Intergenic
1005727613 6:28664973-28664995 ATGTAAGCTCACTGAGTGGAGGG + Intergenic
1006102024 6:31691533-31691555 AGGTGGGGTGAGTGTGAGGAAGG - Intronic
1007759046 6:44121532-44121554 ATGTATGCTCTGTGAGAGCAGGG + Intronic
1008045599 6:46848823-46848845 ATGTAGTTTCAGTGTGTGAAAGG - Intergenic
1011370249 6:86629484-86629506 AATTTGGCTCACTGTGAGGAGGG - Intergenic
1011490296 6:87884582-87884604 ATGAAGGCTCAGGATGGGGAAGG + Intergenic
1012113840 6:95268450-95268472 ATGTGGGTTAAGTGTGAGGAAGG - Intergenic
1012346084 6:98188290-98188312 ATGCAGACTCAATGTAAGGATGG - Intergenic
1018220582 6:161574196-161574218 ATATAAACTCAGTGTGAAGATGG + Intronic
1022463176 7:30631488-30631510 GTTTTGGCTCAGTGGGAGGACGG - Exonic
1022473902 7:30698139-30698161 ATGAAGGCCCCGTGAGAGGAAGG + Intronic
1023168442 7:37366391-37366413 ACGTAGGGTCTCTGTGAGGAAGG + Intronic
1023659946 7:42460903-42460925 CTGCAGGCCCAGTGCGAGGAAGG + Intergenic
1025587563 7:62811084-62811106 ATGTAGGCTTATGGTGAGAAAGG - Intergenic
1029287592 7:99476535-99476557 AAGAGGGCTCAGTCTGAGGAAGG - Intronic
1030188964 7:106791847-106791869 AGGCAGACTCAGTGAGAGGAAGG - Intergenic
1031079965 7:117248870-117248892 ATGTAAACACAGTGTGTGGAAGG - Intergenic
1031744523 7:125477532-125477554 ATTTAGGCTCAGTGAGAAGATGG - Intergenic
1032185372 7:129720601-129720623 ATGTGGGCGCAGGGTGAGAAGGG + Intronic
1033445988 7:141422543-141422565 ACACAGGCTCTGTGTGAGGAAGG - Intronic
1033544322 7:142386165-142386187 TGGTAGGGTCAGAGTGAGGAGGG - Intergenic
1033643126 7:143281590-143281612 TTGTAGGCAAAGTGTGAGGGAGG - Intronic
1034894466 7:154867174-154867196 GTGTAGGCTTAGTGTGAGAAGGG + Intronic
1035756081 8:2034088-2034110 AGTCAGGCTCAGTGTGAGGCTGG - Intergenic
1036678223 8:10852110-10852132 AGGAAGGGTCAGTGCGAGGAAGG + Intergenic
1038184189 8:25258092-25258114 CTGGAAGCTCAGTGAGAGGAAGG - Intronic
1038991956 8:32877837-32877859 ATGTAAGCTCAGTTAGAGCAGGG + Intergenic
1044461213 8:92446581-92446603 ATGTAACCTTAATGTGAGGAAGG + Intergenic
1045243623 8:100423946-100423968 ATGTAAGCTCTGTGAGAGCAGGG - Intergenic
1046983100 8:120358308-120358330 ATGTAGCCTCATTGTAAGAAAGG - Intronic
1048167113 8:132072528-132072550 AAGTAAGCTCTGTGAGAGGAAGG - Intronic
1048286368 8:133144921-133144943 ATTTAGTCTCACTGTGAGAATGG - Intergenic
1049402459 8:142434630-142434652 ATGTAAGTGCACTGTGAGGATGG - Intergenic
1049413085 8:142482244-142482266 ATCAAGGCTCAGTGTGACCAGGG - Intronic
1049413206 8:142482960-142482982 ATCTGGGCTCAGTGTGACCAGGG - Intronic
1053789542 9:41677047-41677069 AACTAGGATCAGTGAGAGGAGGG + Intergenic
1054155601 9:61637705-61637727 AACTAGGATCAGTGAGAGGAGGG - Intergenic
1054177880 9:61888738-61888760 AACTAGGATCAGTGAGAGGAGGG + Intergenic
1054475370 9:65568715-65568737 AACTAGGATCAGTGAGAGGAGGG - Intergenic
1054659649 9:67692086-67692108 AACTAGGATCAGTGAGAGGAGGG - Intergenic
1055329375 9:75167598-75167620 CTGTAGACTCAGTGTGAGGATGG - Intergenic
1056879729 9:90379717-90379739 ATGTAAGCTCTGATTGAGGATGG + Intergenic
1057259234 9:93575198-93575220 ATTTTGGCTCAGTAGGAGGAAGG + Intergenic
1057747233 9:97762052-97762074 ATGGAGGCTCTGTGTGGGGTTGG + Intergenic
1058799903 9:108535441-108535463 ATGGAGGCTGAGTTTTAGGAGGG + Intergenic
1060193929 9:121610772-121610794 ATGCAGGCTCCATGAGAGGAAGG + Intronic
1060269755 9:122132097-122132119 ACGGAGGCTCAGAGAGAGGAAGG - Intergenic
1061192649 9:129090734-129090756 AACAAGGCTCAGTGAGAGGAGGG - Intergenic
1061245023 9:129397205-129397227 ATGAAGGATAAGTGGGAGGATGG + Intergenic
1061575465 9:131503301-131503323 GTGCAGTCTCAGGGTGAGGACGG + Intronic
1061774146 9:132949397-132949419 AGGCTGGTTCAGTGTGAGGAAGG - Intronic
1062184527 9:135210895-135210917 ATGGGGGTTCTGTGTGAGGAAGG - Intergenic
1186175568 X:6922629-6922651 TTGTAAGCTGAGAGTGAGGATGG - Intergenic
1187016772 X:15336488-15336510 ATCAAGGATCAGGGTGAGGAGGG - Intergenic
1188692321 X:33145483-33145505 ATGTAGGCTCTGTGGGAGCAGGG + Intronic
1189211779 X:39289965-39289987 AAGCAGGCTCTGTGTGTGGAGGG + Intergenic
1191710793 X:64148492-64148514 ATGAAGGCTCAGGCTGTGGAGGG - Intergenic
1195423474 X:104701188-104701210 ATGAAGGCTTAGTGTGTGGAAGG + Intronic
1199494873 X:148441733-148441755 CTGTAGTCTCAGTCTGATGAAGG + Intergenic