ID: 1090486346

View in Genome Browser
Species Human (GRCh38)
Location 11:127115949-127115971
Sequence GGGCCCAGCTAGGCGGGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090486346_1090486367 24 Left 1090486346 11:127115949-127115971 CCTCTCCCCGCCTAGCTGGGCCC No data
Right 1090486367 11:127115996-127116018 AGGCGGGAGGCCGAGGGCAGCGG No data
1090486346_1090486355 4 Left 1090486346 11:127115949-127115971 CCTCTCCCCGCCTAGCTGGGCCC No data
Right 1090486355 11:127115976-127115998 GGCTCCCCTCCGCAACCCTAAGG No data
1090486346_1090486363 17 Left 1090486346 11:127115949-127115971 CCTCTCCCCGCCTAGCTGGGCCC No data
Right 1090486363 11:127115989-127116011 AACCCTAAGGCGGGAGGCCGAGG No data
1090486346_1090486361 11 Left 1090486346 11:127115949-127115971 CCTCTCCCCGCCTAGCTGGGCCC No data
Right 1090486361 11:127115983-127116005 CTCCGCAACCCTAAGGCGGGAGG No data
1090486346_1090486364 18 Left 1090486346 11:127115949-127115971 CCTCTCCCCGCCTAGCTGGGCCC No data
Right 1090486364 11:127115990-127116012 ACCCTAAGGCGGGAGGCCGAGGG No data
1090486346_1090486356 7 Left 1090486346 11:127115949-127115971 CCTCTCCCCGCCTAGCTGGGCCC No data
Right 1090486356 11:127115979-127116001 TCCCCTCCGCAACCCTAAGGCGG No data
1090486346_1090486368 25 Left 1090486346 11:127115949-127115971 CCTCTCCCCGCCTAGCTGGGCCC No data
Right 1090486368 11:127115997-127116019 GGCGGGAGGCCGAGGGCAGCGGG No data
1090486346_1090486369 26 Left 1090486346 11:127115949-127115971 CCTCTCCCCGCCTAGCTGGGCCC No data
Right 1090486369 11:127115998-127116020 GCGGGAGGCCGAGGGCAGCGGGG No data
1090486346_1090486358 8 Left 1090486346 11:127115949-127115971 CCTCTCCCCGCCTAGCTGGGCCC No data
Right 1090486358 11:127115980-127116002 CCCCTCCGCAACCCTAAGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090486346 Original CRISPR GGGCCCAGCTAGGCGGGGAG AGG (reversed) Intergenic
No off target data available for this crispr