ID: 1090486349

View in Genome Browser
Species Human (GRCh38)
Location 11:127115955-127115977
Sequence CCCACAGGGCCCAGCTAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090486349_1090486369 20 Left 1090486349 11:127115955-127115977 CCCGCCTAGCTGGGCCCTGTGGG No data
Right 1090486369 11:127115998-127116020 GCGGGAGGCCGAGGGCAGCGGGG No data
1090486349_1090486363 11 Left 1090486349 11:127115955-127115977 CCCGCCTAGCTGGGCCCTGTGGG No data
Right 1090486363 11:127115989-127116011 AACCCTAAGGCGGGAGGCCGAGG No data
1090486349_1090486367 18 Left 1090486349 11:127115955-127115977 CCCGCCTAGCTGGGCCCTGTGGG No data
Right 1090486367 11:127115996-127116018 AGGCGGGAGGCCGAGGGCAGCGG No data
1090486349_1090486356 1 Left 1090486349 11:127115955-127115977 CCCGCCTAGCTGGGCCCTGTGGG No data
Right 1090486356 11:127115979-127116001 TCCCCTCCGCAACCCTAAGGCGG No data
1090486349_1090486364 12 Left 1090486349 11:127115955-127115977 CCCGCCTAGCTGGGCCCTGTGGG No data
Right 1090486364 11:127115990-127116012 ACCCTAAGGCGGGAGGCCGAGGG No data
1090486349_1090486358 2 Left 1090486349 11:127115955-127115977 CCCGCCTAGCTGGGCCCTGTGGG No data
Right 1090486358 11:127115980-127116002 CCCCTCCGCAACCCTAAGGCGGG No data
1090486349_1090486361 5 Left 1090486349 11:127115955-127115977 CCCGCCTAGCTGGGCCCTGTGGG No data
Right 1090486361 11:127115983-127116005 CTCCGCAACCCTAAGGCGGGAGG No data
1090486349_1090486368 19 Left 1090486349 11:127115955-127115977 CCCGCCTAGCTGGGCCCTGTGGG No data
Right 1090486368 11:127115997-127116019 GGCGGGAGGCCGAGGGCAGCGGG No data
1090486349_1090486355 -2 Left 1090486349 11:127115955-127115977 CCCGCCTAGCTGGGCCCTGTGGG No data
Right 1090486355 11:127115976-127115998 GGCTCCCCTCCGCAACCCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090486349 Original CRISPR CCCACAGGGCCCAGCTAGGC GGG (reversed) Intergenic