ID: 1090486353

View in Genome Browser
Species Human (GRCh38)
Location 11:127115969-127115991
Sequence GTTGCGGAGGGGAGCCCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090486353_1090486367 4 Left 1090486353 11:127115969-127115991 CCCTGTGGGCTCCCCTCCGCAAC No data
Right 1090486367 11:127115996-127116018 AGGCGGGAGGCCGAGGGCAGCGG No data
1090486353_1090486369 6 Left 1090486353 11:127115969-127115991 CCCTGTGGGCTCCCCTCCGCAAC No data
Right 1090486369 11:127115998-127116020 GCGGGAGGCCGAGGGCAGCGGGG No data
1090486353_1090486368 5 Left 1090486353 11:127115969-127115991 CCCTGTGGGCTCCCCTCCGCAAC No data
Right 1090486368 11:127115997-127116019 GGCGGGAGGCCGAGGGCAGCGGG No data
1090486353_1090486363 -3 Left 1090486353 11:127115969-127115991 CCCTGTGGGCTCCCCTCCGCAAC No data
Right 1090486363 11:127115989-127116011 AACCCTAAGGCGGGAGGCCGAGG No data
1090486353_1090486364 -2 Left 1090486353 11:127115969-127115991 CCCTGTGGGCTCCCCTCCGCAAC No data
Right 1090486364 11:127115990-127116012 ACCCTAAGGCGGGAGGCCGAGGG No data
1090486353_1090486361 -9 Left 1090486353 11:127115969-127115991 CCCTGTGGGCTCCCCTCCGCAAC No data
Right 1090486361 11:127115983-127116005 CTCCGCAACCCTAAGGCGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090486353 Original CRISPR GTTGCGGAGGGGAGCCCACA GGG (reversed) Intergenic