ID: 1090486354

View in Genome Browser
Species Human (GRCh38)
Location 11:127115970-127115992
Sequence GGTTGCGGAGGGGAGCCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090486354_1090486361 -10 Left 1090486354 11:127115970-127115992 CCTGTGGGCTCCCCTCCGCAACC No data
Right 1090486361 11:127115983-127116005 CTCCGCAACCCTAAGGCGGGAGG No data
1090486354_1090486367 3 Left 1090486354 11:127115970-127115992 CCTGTGGGCTCCCCTCCGCAACC No data
Right 1090486367 11:127115996-127116018 AGGCGGGAGGCCGAGGGCAGCGG No data
1090486354_1090486363 -4 Left 1090486354 11:127115970-127115992 CCTGTGGGCTCCCCTCCGCAACC No data
Right 1090486363 11:127115989-127116011 AACCCTAAGGCGGGAGGCCGAGG No data
1090486354_1090486368 4 Left 1090486354 11:127115970-127115992 CCTGTGGGCTCCCCTCCGCAACC No data
Right 1090486368 11:127115997-127116019 GGCGGGAGGCCGAGGGCAGCGGG No data
1090486354_1090486369 5 Left 1090486354 11:127115970-127115992 CCTGTGGGCTCCCCTCCGCAACC No data
Right 1090486369 11:127115998-127116020 GCGGGAGGCCGAGGGCAGCGGGG No data
1090486354_1090486364 -3 Left 1090486354 11:127115970-127115992 CCTGTGGGCTCCCCTCCGCAACC No data
Right 1090486364 11:127115990-127116012 ACCCTAAGGCGGGAGGCCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090486354 Original CRISPR GGTTGCGGAGGGGAGCCCAC AGG (reversed) Intergenic