ID: 1090486357

View in Genome Browser
Species Human (GRCh38)
Location 11:127115980-127116002
Sequence CCCGCCTTAGGGTTGCGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090486357_1090486368 -6 Left 1090486357 11:127115980-127116002 CCCCTCCGCAACCCTAAGGCGGG No data
Right 1090486368 11:127115997-127116019 GGCGGGAGGCCGAGGGCAGCGGG No data
1090486357_1090486367 -7 Left 1090486357 11:127115980-127116002 CCCCTCCGCAACCCTAAGGCGGG No data
Right 1090486367 11:127115996-127116018 AGGCGGGAGGCCGAGGGCAGCGG No data
1090486357_1090486369 -5 Left 1090486357 11:127115980-127116002 CCCCTCCGCAACCCTAAGGCGGG No data
Right 1090486369 11:127115998-127116020 GCGGGAGGCCGAGGGCAGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090486357 Original CRISPR CCCGCCTTAGGGTTGCGGAG GGG (reversed) Intergenic