ID: 1090486358

View in Genome Browser
Species Human (GRCh38)
Location 11:127115980-127116002
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090486352_1090486358 -2 Left 1090486352 11:127115959-127115981 CCTAGCTGGGCCCTGTGGGCTCC No data
Right 1090486358 11:127115980-127116002 CCCCTCCGCAACCCTAAGGCGGG No data
1090486349_1090486358 2 Left 1090486349 11:127115955-127115977 CCCGCCTAGCTGGGCCCTGTGGG No data
Right 1090486358 11:127115980-127116002 CCCCTCCGCAACCCTAAGGCGGG No data
1090486347_1090486358 3 Left 1090486347 11:127115954-127115976 CCCCGCCTAGCTGGGCCCTGTGG No data
Right 1090486358 11:127115980-127116002 CCCCTCCGCAACCCTAAGGCGGG No data
1090486351_1090486358 1 Left 1090486351 11:127115956-127115978 CCGCCTAGCTGGGCCCTGTGGGC No data
Right 1090486358 11:127115980-127116002 CCCCTCCGCAACCCTAAGGCGGG No data
1090486346_1090486358 8 Left 1090486346 11:127115949-127115971 CCTCTCCCCGCCTAGCTGGGCCC No data
Right 1090486358 11:127115980-127116002 CCCCTCCGCAACCCTAAGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090486358 Original CRISPR CCCCTCCGCAACCCTAAGGC GGG Intergenic