ID: 1090486360

View in Genome Browser
Species Human (GRCh38)
Location 11:127115982-127116004
Sequence CTCCCGCCTTAGGGTTGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090486360_1090486372 30 Left 1090486360 11:127115982-127116004 CCTCCGCAACCCTAAGGCGGGAG No data
Right 1090486372 11:127116035-127116057 TTCGCCCCTCATTTGACCCATGG No data
1090486360_1090486368 -8 Left 1090486360 11:127115982-127116004 CCTCCGCAACCCTAAGGCGGGAG No data
Right 1090486368 11:127115997-127116019 GGCGGGAGGCCGAGGGCAGCGGG No data
1090486360_1090486367 -9 Left 1090486360 11:127115982-127116004 CCTCCGCAACCCTAAGGCGGGAG No data
Right 1090486367 11:127115996-127116018 AGGCGGGAGGCCGAGGGCAGCGG No data
1090486360_1090486369 -7 Left 1090486360 11:127115982-127116004 CCTCCGCAACCCTAAGGCGGGAG No data
Right 1090486369 11:127115998-127116020 GCGGGAGGCCGAGGGCAGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090486360 Original CRISPR CTCCCGCCTTAGGGTTGCGG AGG (reversed) Intergenic