ID: 1090486362

View in Genome Browser
Species Human (GRCh38)
Location 11:127115985-127116007
Sequence GGCCTCCCGCCTTAGGGTTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090486362_1090486369 -10 Left 1090486362 11:127115985-127116007 CCGCAACCCTAAGGCGGGAGGCC No data
Right 1090486369 11:127115998-127116020 GCGGGAGGCCGAGGGCAGCGGGG No data
1090486362_1090486372 27 Left 1090486362 11:127115985-127116007 CCGCAACCCTAAGGCGGGAGGCC No data
Right 1090486372 11:127116035-127116057 TTCGCCCCTCATTTGACCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090486362 Original CRISPR GGCCTCCCGCCTTAGGGTTG CGG (reversed) Intergenic