ID: 1090486364

View in Genome Browser
Species Human (GRCh38)
Location 11:127115990-127116012
Sequence ACCCTAAGGCGGGAGGCCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090486351_1090486364 11 Left 1090486351 11:127115956-127115978 CCGCCTAGCTGGGCCCTGTGGGC No data
Right 1090486364 11:127115990-127116012 ACCCTAAGGCGGGAGGCCGAGGG No data
1090486352_1090486364 8 Left 1090486352 11:127115959-127115981 CCTAGCTGGGCCCTGTGGGCTCC No data
Right 1090486364 11:127115990-127116012 ACCCTAAGGCGGGAGGCCGAGGG No data
1090486347_1090486364 13 Left 1090486347 11:127115954-127115976 CCCCGCCTAGCTGGGCCCTGTGG No data
Right 1090486364 11:127115990-127116012 ACCCTAAGGCGGGAGGCCGAGGG No data
1090486346_1090486364 18 Left 1090486346 11:127115949-127115971 CCTCTCCCCGCCTAGCTGGGCCC No data
Right 1090486364 11:127115990-127116012 ACCCTAAGGCGGGAGGCCGAGGG No data
1090486353_1090486364 -2 Left 1090486353 11:127115969-127115991 CCCTGTGGGCTCCCCTCCGCAAC No data
Right 1090486364 11:127115990-127116012 ACCCTAAGGCGGGAGGCCGAGGG No data
1090486354_1090486364 -3 Left 1090486354 11:127115970-127115992 CCTGTGGGCTCCCCTCCGCAACC No data
Right 1090486364 11:127115990-127116012 ACCCTAAGGCGGGAGGCCGAGGG No data
1090486349_1090486364 12 Left 1090486349 11:127115955-127115977 CCCGCCTAGCTGGGCCCTGTGGG No data
Right 1090486364 11:127115990-127116012 ACCCTAAGGCGGGAGGCCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090486364 Original CRISPR ACCCTAAGGCGGGAGGCCGA GGG Intergenic
No off target data available for this crispr