ID: 1090486367

View in Genome Browser
Species Human (GRCh38)
Location 11:127115996-127116018
Sequence AGGCGGGAGGCCGAGGGCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090486351_1090486367 17 Left 1090486351 11:127115956-127115978 CCGCCTAGCTGGGCCCTGTGGGC No data
Right 1090486367 11:127115996-127116018 AGGCGGGAGGCCGAGGGCAGCGG No data
1090486347_1090486367 19 Left 1090486347 11:127115954-127115976 CCCCGCCTAGCTGGGCCCTGTGG No data
Right 1090486367 11:127115996-127116018 AGGCGGGAGGCCGAGGGCAGCGG No data
1090486359_1090486367 -8 Left 1090486359 11:127115981-127116003 CCCTCCGCAACCCTAAGGCGGGA No data
Right 1090486367 11:127115996-127116018 AGGCGGGAGGCCGAGGGCAGCGG No data
1090486354_1090486367 3 Left 1090486354 11:127115970-127115992 CCTGTGGGCTCCCCTCCGCAACC No data
Right 1090486367 11:127115996-127116018 AGGCGGGAGGCCGAGGGCAGCGG No data
1090486353_1090486367 4 Left 1090486353 11:127115969-127115991 CCCTGTGGGCTCCCCTCCGCAAC No data
Right 1090486367 11:127115996-127116018 AGGCGGGAGGCCGAGGGCAGCGG No data
1090486346_1090486367 24 Left 1090486346 11:127115949-127115971 CCTCTCCCCGCCTAGCTGGGCCC No data
Right 1090486367 11:127115996-127116018 AGGCGGGAGGCCGAGGGCAGCGG No data
1090486349_1090486367 18 Left 1090486349 11:127115955-127115977 CCCGCCTAGCTGGGCCCTGTGGG No data
Right 1090486367 11:127115996-127116018 AGGCGGGAGGCCGAGGGCAGCGG No data
1090486357_1090486367 -7 Left 1090486357 11:127115980-127116002 CCCCTCCGCAACCCTAAGGCGGG No data
Right 1090486367 11:127115996-127116018 AGGCGGGAGGCCGAGGGCAGCGG No data
1090486352_1090486367 14 Left 1090486352 11:127115959-127115981 CCTAGCTGGGCCCTGTGGGCTCC No data
Right 1090486367 11:127115996-127116018 AGGCGGGAGGCCGAGGGCAGCGG No data
1090486360_1090486367 -9 Left 1090486360 11:127115982-127116004 CCTCCGCAACCCTAAGGCGGGAG No data
Right 1090486367 11:127115996-127116018 AGGCGGGAGGCCGAGGGCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090486367 Original CRISPR AGGCGGGAGGCCGAGGGCAG CGG Intergenic