ID: 1090486369

View in Genome Browser
Species Human (GRCh38)
Location 11:127115998-127116020
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090486352_1090486369 16 Left 1090486352 11:127115959-127115981 CCTAGCTGGGCCCTGTGGGCTCC No data
Right 1090486369 11:127115998-127116020 GCGGGAGGCCGAGGGCAGCGGGG No data
1090486362_1090486369 -10 Left 1090486362 11:127115985-127116007 CCGCAACCCTAAGGCGGGAGGCC No data
Right 1090486369 11:127115998-127116020 GCGGGAGGCCGAGGGCAGCGGGG No data
1090486354_1090486369 5 Left 1090486354 11:127115970-127115992 CCTGTGGGCTCCCCTCCGCAACC No data
Right 1090486369 11:127115998-127116020 GCGGGAGGCCGAGGGCAGCGGGG No data
1090486359_1090486369 -6 Left 1090486359 11:127115981-127116003 CCCTCCGCAACCCTAAGGCGGGA No data
Right 1090486369 11:127115998-127116020 GCGGGAGGCCGAGGGCAGCGGGG No data
1090486347_1090486369 21 Left 1090486347 11:127115954-127115976 CCCCGCCTAGCTGGGCCCTGTGG No data
Right 1090486369 11:127115998-127116020 GCGGGAGGCCGAGGGCAGCGGGG No data
1090486353_1090486369 6 Left 1090486353 11:127115969-127115991 CCCTGTGGGCTCCCCTCCGCAAC No data
Right 1090486369 11:127115998-127116020 GCGGGAGGCCGAGGGCAGCGGGG No data
1090486360_1090486369 -7 Left 1090486360 11:127115982-127116004 CCTCCGCAACCCTAAGGCGGGAG No data
Right 1090486369 11:127115998-127116020 GCGGGAGGCCGAGGGCAGCGGGG No data
1090486346_1090486369 26 Left 1090486346 11:127115949-127115971 CCTCTCCCCGCCTAGCTGGGCCC No data
Right 1090486369 11:127115998-127116020 GCGGGAGGCCGAGGGCAGCGGGG No data
1090486357_1090486369 -5 Left 1090486357 11:127115980-127116002 CCCCTCCGCAACCCTAAGGCGGG No data
Right 1090486369 11:127115998-127116020 GCGGGAGGCCGAGGGCAGCGGGG No data
1090486349_1090486369 20 Left 1090486349 11:127115955-127115977 CCCGCCTAGCTGGGCCCTGTGGG No data
Right 1090486369 11:127115998-127116020 GCGGGAGGCCGAGGGCAGCGGGG No data
1090486351_1090486369 19 Left 1090486351 11:127115956-127115978 CCGCCTAGCTGGGCCCTGTGGGC No data
Right 1090486369 11:127115998-127116020 GCGGGAGGCCGAGGGCAGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090486369 Original CRISPR GCGGGAGGCCGAGGGCAGCG GGG Intergenic
No off target data available for this crispr