ID: 1090486372

View in Genome Browser
Species Human (GRCh38)
Location 11:127116035-127116057
Sequence TTCGCCCCTCATTTGACCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090486366_1090486372 20 Left 1090486366 11:127115992-127116014 CCTAAGGCGGGAGGCCGAGGGCA No data
Right 1090486372 11:127116035-127116057 TTCGCCCCTCATTTGACCCATGG No data
1090486365_1090486372 21 Left 1090486365 11:127115991-127116013 CCCTAAGGCGGGAGGCCGAGGGC No data
Right 1090486372 11:127116035-127116057 TTCGCCCCTCATTTGACCCATGG No data
1090486362_1090486372 27 Left 1090486362 11:127115985-127116007 CCGCAACCCTAAGGCGGGAGGCC No data
Right 1090486372 11:127116035-127116057 TTCGCCCCTCATTTGACCCATGG No data
1090486370_1090486372 6 Left 1090486370 11:127116006-127116028 CCGAGGGCAGCGGGGAGTCGCGC No data
Right 1090486372 11:127116035-127116057 TTCGCCCCTCATTTGACCCATGG No data
1090486360_1090486372 30 Left 1090486360 11:127115982-127116004 CCTCCGCAACCCTAAGGCGGGAG No data
Right 1090486372 11:127116035-127116057 TTCGCCCCTCATTTGACCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090486372 Original CRISPR TTCGCCCCTCATTTGACCCA TGG Intergenic