ID: 1090487021

View in Genome Browser
Species Human (GRCh38)
Location 11:127122278-127122300
Sequence AACCTTGAATTCCAAGTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090487020_1090487021 30 Left 1090487020 11:127122225-127122247 CCTGTTTGTGTATGGTGTGGGGA No data
Right 1090487021 11:127122278-127122300 AACCTTGAATTCCAAGTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090487021 Original CRISPR AACCTTGAATTCCAAGTGAC TGG Intergenic
No off target data available for this crispr