ID: 1090487705

View in Genome Browser
Species Human (GRCh38)
Location 11:127128882-127128904
Sequence CTGGGGGCTCAGGATCTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090487705_1090487712 -2 Left 1090487705 11:127128882-127128904 CCAACCAGATCCTGAGCCCCCAG No data
Right 1090487712 11:127128903-127128925 AGTCCAGCCCACCTCCCCCCAGG No data
1090487705_1090487715 5 Left 1090487705 11:127128882-127128904 CCAACCAGATCCTGAGCCCCCAG No data
Right 1090487715 11:127128910-127128932 CCCACCTCCCCCCAGGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090487705 Original CRISPR CTGGGGGCTCAGGATCTGGT TGG (reversed) Intergenic
No off target data available for this crispr