ID: 1090492252

View in Genome Browser
Species Human (GRCh38)
Location 11:127175132-127175154
Sequence AGCTTCTGTAGCCCTGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090492252_1090492254 13 Left 1090492252 11:127175132-127175154 CCACCTTCAGGGCTACAGAAGCT No data
Right 1090492254 11:127175168-127175190 GACTTTTGAGCTTTTAATGAAGG No data
1090492252_1090492255 22 Left 1090492252 11:127175132-127175154 CCACCTTCAGGGCTACAGAAGCT No data
Right 1090492255 11:127175177-127175199 GCTTTTAATGAAGGACAAGCAGG No data
1090492252_1090492256 23 Left 1090492252 11:127175132-127175154 CCACCTTCAGGGCTACAGAAGCT No data
Right 1090492256 11:127175178-127175200 CTTTTAATGAAGGACAAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090492252 Original CRISPR AGCTTCTGTAGCCCTGAAGG TGG (reversed) Intergenic
No off target data available for this crispr