ID: 1090492255

View in Genome Browser
Species Human (GRCh38)
Location 11:127175177-127175199
Sequence GCTTTTAATGAAGGACAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090492253_1090492255 19 Left 1090492253 11:127175135-127175157 CCTTCAGGGCTACAGAAGCTTCA No data
Right 1090492255 11:127175177-127175199 GCTTTTAATGAAGGACAAGCAGG No data
1090492252_1090492255 22 Left 1090492252 11:127175132-127175154 CCACCTTCAGGGCTACAGAAGCT No data
Right 1090492255 11:127175177-127175199 GCTTTTAATGAAGGACAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090492255 Original CRISPR GCTTTTAATGAAGGACAAGC AGG Intergenic
No off target data available for this crispr