ID: 1090497343

View in Genome Browser
Species Human (GRCh38)
Location 11:127226580-127226602
Sequence GAGCAATCACTCCACTTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090497343_1090497346 11 Left 1090497343 11:127226580-127226602 CCAGAGAAGTGGAGTGATTGCTC No data
Right 1090497346 11:127226614-127226636 GGAAAGCTATTGCAAGAGCCAGG No data
1090497343_1090497345 -10 Left 1090497343 11:127226580-127226602 CCAGAGAAGTGGAGTGATTGCTC No data
Right 1090497345 11:127226593-127226615 GTGATTGCTCATGAGATCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090497343 Original CRISPR GAGCAATCACTCCACTTCTC TGG (reversed) Intergenic