ID: 1090497343 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:127226580-127226602 |
| Sequence | GAGCAATCACTCCACTTCTC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1090497343_1090497346 | 11 | Left | 1090497343 | 11:127226580-127226602 | CCAGAGAAGTGGAGTGATTGCTC | No data | ||
| Right | 1090497346 | 11:127226614-127226636 | GGAAAGCTATTGCAAGAGCCAGG | No data | ||||
| 1090497343_1090497345 | -10 | Left | 1090497343 | 11:127226580-127226602 | CCAGAGAAGTGGAGTGATTGCTC | No data | ||
| Right | 1090497345 | 11:127226593-127226615 | GTGATTGCTCATGAGATCATGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1090497343 | Original CRISPR | GAGCAATCACTCCACTTCTC TGG (reversed) | Intergenic | ||