ID: 1090501505

View in Genome Browser
Species Human (GRCh38)
Location 11:127265670-127265692
Sequence GGCCCTAAAAATATTGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090501502_1090501505 -3 Left 1090501502 11:127265650-127265672 CCATTTGTACTCGTTCTCTAGGC No data
Right 1090501505 11:127265670-127265692 GGCCCTAAAAATATTGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090501505 Original CRISPR GGCCCTAAAAATATTGAGGG TGG Intergenic
No off target data available for this crispr