ID: 1090502420

View in Genome Browser
Species Human (GRCh38)
Location 11:127274519-127274541
Sequence GAACAAGACTTGGCAAATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090502415_1090502420 -10 Left 1090502415 11:127274506-127274528 CCCCCAGGATAATGAACAAGACT No data
Right 1090502420 11:127274519-127274541 GAACAAGACTTGGCAAATACTGG No data
1090502413_1090502420 27 Left 1090502413 11:127274469-127274491 CCAGGAACATTTCTTCTGTATGT No data
Right 1090502420 11:127274519-127274541 GAACAAGACTTGGCAAATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090502420 Original CRISPR GAACAAGACTTGGCAAATAC TGG Intergenic
No off target data available for this crispr