ID: 1090506603

View in Genome Browser
Species Human (GRCh38)
Location 11:127321514-127321536
Sequence TAAAATGCTGATAGTGTTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090506603_1090506605 4 Left 1090506603 11:127321514-127321536 CCCATAACACTATCAGCATTTTA No data
Right 1090506605 11:127321541-127321563 AAGCCACTCAACAAGTCTCTAGG 0: 47
1: 1513
2: 1901
3: 1391
4: 857

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090506603 Original CRISPR TAAAATGCTGATAGTGTTAT GGG (reversed) Intergenic
No off target data available for this crispr