ID: 1090508546

View in Genome Browser
Species Human (GRCh38)
Location 11:127346236-127346258
Sequence TCTTGACCTCGGACGCCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090508546_1090508550 -6 Left 1090508546 11:127346236-127346258 CCCAGAGGCGTCCGAGGTCAAGA No data
Right 1090508550 11:127346253-127346275 TCAAGAAGAAAGAAAACAGAGGG No data
1090508546_1090508551 0 Left 1090508546 11:127346236-127346258 CCCAGAGGCGTCCGAGGTCAAGA No data
Right 1090508551 11:127346259-127346281 AGAAAGAAAACAGAGGGATTTGG No data
1090508546_1090508553 13 Left 1090508546 11:127346236-127346258 CCCAGAGGCGTCCGAGGTCAAGA No data
Right 1090508553 11:127346272-127346294 AGGGATTTGGAAAGCAGCAAGGG No data
1090508546_1090508552 12 Left 1090508546 11:127346236-127346258 CCCAGAGGCGTCCGAGGTCAAGA No data
Right 1090508552 11:127346271-127346293 GAGGGATTTGGAAAGCAGCAAGG No data
1090508546_1090508549 -7 Left 1090508546 11:127346236-127346258 CCCAGAGGCGTCCGAGGTCAAGA No data
Right 1090508549 11:127346252-127346274 GTCAAGAAGAAAGAAAACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090508546 Original CRISPR TCTTGACCTCGGACGCCTCT GGG (reversed) Intergenic