ID: 1090510632

View in Genome Browser
Species Human (GRCh38)
Location 11:127371065-127371087
Sequence ATGGAGAAGAGAGATGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090510632_1090510636 21 Left 1090510632 11:127371065-127371087 CCTTTCTCATCTCTCTTCTCCAT No data
Right 1090510636 11:127371109-127371131 AAGCATGAGTTCTAGCAGCCAGG No data
1090510632_1090510637 22 Left 1090510632 11:127371065-127371087 CCTTTCTCATCTCTCTTCTCCAT No data
Right 1090510637 11:127371110-127371132 AGCATGAGTTCTAGCAGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090510632 Original CRISPR ATGGAGAAGAGAGATGAGAA AGG (reversed) Intergenic
No off target data available for this crispr