ID: 1090510659

View in Genome Browser
Species Human (GRCh38)
Location 11:127371248-127371270
Sequence GATCTGAATCTCCCTACACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090510659_1090510661 25 Left 1090510659 11:127371248-127371270 CCATGTGTAGGGAGATTCAGATC No data
Right 1090510661 11:127371296-127371318 ATTGTCAAGATAGCTCAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090510659 Original CRISPR GATCTGAATCTCCCTACACA TGG (reversed) Intergenic
No off target data available for this crispr