ID: 1090515698

View in Genome Browser
Species Human (GRCh38)
Location 11:127423999-127424021
Sequence AGTTTTAAGCAGGAGTGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090515695_1090515698 -8 Left 1090515695 11:127423984-127424006 CCTCTACTAAAGGTTAGTTTTAA No data
Right 1090515698 11:127423999-127424021 AGTTTTAAGCAGGAGTGGCATGG No data
1090515693_1090515698 -6 Left 1090515693 11:127423982-127424004 CCCCTCTACTAAAGGTTAGTTTT No data
Right 1090515698 11:127423999-127424021 AGTTTTAAGCAGGAGTGGCATGG No data
1090515690_1090515698 8 Left 1090515690 11:127423968-127423990 CCCGTCTTGCTCTGCCCCTCTAC No data
Right 1090515698 11:127423999-127424021 AGTTTTAAGCAGGAGTGGCATGG No data
1090515691_1090515698 7 Left 1090515691 11:127423969-127423991 CCGTCTTGCTCTGCCCCTCTACT No data
Right 1090515698 11:127423999-127424021 AGTTTTAAGCAGGAGTGGCATGG No data
1090515694_1090515698 -7 Left 1090515694 11:127423983-127424005 CCCTCTACTAAAGGTTAGTTTTA No data
Right 1090515698 11:127423999-127424021 AGTTTTAAGCAGGAGTGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090515698 Original CRISPR AGTTTTAAGCAGGAGTGGCA TGG Intergenic
No off target data available for this crispr