ID: 1090517890

View in Genome Browser
Species Human (GRCh38)
Location 11:127448183-127448205
Sequence GCTCCAGGCAGGCCGGACGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090517890_1090517897 18 Left 1090517890 11:127448183-127448205 CCTCCGTCCGGCCTGCCTGGAGC No data
Right 1090517897 11:127448224-127448246 TCCCTATAGTCTTCTTGCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090517890 Original CRISPR GCTCCAGGCAGGCCGGACGG AGG (reversed) Intergenic
No off target data available for this crispr