ID: 1090517897

View in Genome Browser
Species Human (GRCh38)
Location 11:127448224-127448246
Sequence TCCCTATAGTCTTCTTGCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090517895_1090517897 -4 Left 1090517895 11:127448205-127448227 CCTGCTCCTTTCAGATTACTCCC No data
Right 1090517897 11:127448224-127448246 TCCCTATAGTCTTCTTGCCGTGG No data
1090517896_1090517897 -10 Left 1090517896 11:127448211-127448233 CCTTTCAGATTACTCCCTATAGT No data
Right 1090517897 11:127448224-127448246 TCCCTATAGTCTTCTTGCCGTGG No data
1090517893_1090517897 7 Left 1090517893 11:127448194-127448216 CCTGCCTGGAGCCTGCTCCTTTC No data
Right 1090517897 11:127448224-127448246 TCCCTATAGTCTTCTTGCCGTGG No data
1090517891_1090517897 15 Left 1090517891 11:127448186-127448208 CCGTCCGGCCTGCCTGGAGCCTG No data
Right 1090517897 11:127448224-127448246 TCCCTATAGTCTTCTTGCCGTGG No data
1090517894_1090517897 3 Left 1090517894 11:127448198-127448220 CCTGGAGCCTGCTCCTTTCAGAT No data
Right 1090517897 11:127448224-127448246 TCCCTATAGTCTTCTTGCCGTGG No data
1090517890_1090517897 18 Left 1090517890 11:127448183-127448205 CCTCCGTCCGGCCTGCCTGGAGC No data
Right 1090517897 11:127448224-127448246 TCCCTATAGTCTTCTTGCCGTGG No data
1090517892_1090517897 11 Left 1090517892 11:127448190-127448212 CCGGCCTGCCTGGAGCCTGCTCC No data
Right 1090517897 11:127448224-127448246 TCCCTATAGTCTTCTTGCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090517897 Original CRISPR TCCCTATAGTCTTCTTGCCG TGG Intergenic