ID: 1090519942

View in Genome Browser
Species Human (GRCh38)
Location 11:127467742-127467764
Sequence TAAGTGAGATCGTATTTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090519942_1090519945 -2 Left 1090519942 11:127467742-127467764 CCATAAAAATACGATCTCACTTA No data
Right 1090519945 11:127467763-127467785 TATTCATCATGGGTGCGATAAGG No data
1090519942_1090519947 8 Left 1090519942 11:127467742-127467764 CCATAAAAATACGATCTCACTTA No data
Right 1090519947 11:127467773-127467795 GGGTGCGATAAGGCTTCTTAGGG No data
1090519942_1090519946 7 Left 1090519942 11:127467742-127467764 CCATAAAAATACGATCTCACTTA No data
Right 1090519946 11:127467772-127467794 TGGGTGCGATAAGGCTTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090519942 Original CRISPR TAAGTGAGATCGTATTTTTA TGG (reversed) Intergenic
No off target data available for this crispr