ID: 1090519947

View in Genome Browser
Species Human (GRCh38)
Location 11:127467773-127467795
Sequence GGGTGCGATAAGGCTTCTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090519942_1090519947 8 Left 1090519942 11:127467742-127467764 CCATAAAAATACGATCTCACTTA No data
Right 1090519947 11:127467773-127467795 GGGTGCGATAAGGCTTCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090519947 Original CRISPR GGGTGCGATAAGGCTTCTTA GGG Intergenic
No off target data available for this crispr