ID: 1090520166

View in Genome Browser
Species Human (GRCh38)
Location 11:127470667-127470689
Sequence GTTTAGCCATGCAGCCACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090520163_1090520166 8 Left 1090520163 11:127470636-127470658 CCTCAAAGGAGGTGATTTCCAGA No data
Right 1090520166 11:127470667-127470689 GTTTAGCCATGCAGCCACCAGGG No data
1090520164_1090520166 -10 Left 1090520164 11:127470654-127470676 CCAGAAAGCTACAGTTTAGCCAT No data
Right 1090520166 11:127470667-127470689 GTTTAGCCATGCAGCCACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090520166 Original CRISPR GTTTAGCCATGCAGCCACCA GGG Intergenic
No off target data available for this crispr