ID: 1090521356

View in Genome Browser
Species Human (GRCh38)
Location 11:127482995-127483017
Sequence TTCTGCAGGCTATACAAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090521352_1090521356 15 Left 1090521352 11:127482957-127482979 CCTGTTCAATTAAATCAAGAGGT No data
Right 1090521356 11:127482995-127483017 TTCTGCAGGCTATACAAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090521356 Original CRISPR TTCTGCAGGCTATACAAGGA TGG Intergenic
No off target data available for this crispr