ID: 1090525995

View in Genome Browser
Species Human (GRCh38)
Location 11:127537444-127537466
Sequence TGACTCAGTACAGAGTAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090525995_1090525998 -7 Left 1090525995 11:127537444-127537466 CCTGCTTACTCTGTACTGAGTCA No data
Right 1090525998 11:127537460-127537482 TGAGTCAGGGTGAAGAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090525995 Original CRISPR TGACTCAGTACAGAGTAAGC AGG (reversed) Intergenic