ID: 1090525998

View in Genome Browser
Species Human (GRCh38)
Location 11:127537460-127537482
Sequence TGAGTCAGGGTGAAGAGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090525995_1090525998 -7 Left 1090525995 11:127537444-127537466 CCTGCTTACTCTGTACTGAGTCA No data
Right 1090525998 11:127537460-127537482 TGAGTCAGGGTGAAGAGCTCTGG No data
1090525993_1090525998 25 Left 1090525993 11:127537412-127537434 CCTAGAGAGAAGATGGGAGCTGG No data
Right 1090525998 11:127537460-127537482 TGAGTCAGGGTGAAGAGCTCTGG No data
1090525992_1090525998 29 Left 1090525992 11:127537408-127537430 CCTTCCTAGAGAGAAGATGGGAG No data
Right 1090525998 11:127537460-127537482 TGAGTCAGGGTGAAGAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090525998 Original CRISPR TGAGTCAGGGTGAAGAGCTC TGG Intergenic