ID: 1090526090

View in Genome Browser
Species Human (GRCh38)
Location 11:127538826-127538848
Sequence TAGAACTATCACTTAAAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090526087_1090526090 -2 Left 1090526087 11:127538805-127538827 CCAACTCCTTGCCTCTTCTCTTA No data
Right 1090526090 11:127538826-127538848 TAGAACTATCACTTAAAAGTTGG No data
1090526086_1090526090 -1 Left 1090526086 11:127538804-127538826 CCCAACTCCTTGCCTCTTCTCTT No data
Right 1090526090 11:127538826-127538848 TAGAACTATCACTTAAAAGTTGG No data
1090526088_1090526090 -8 Left 1090526088 11:127538811-127538833 CCTTGCCTCTTCTCTTAGAACTA No data
Right 1090526090 11:127538826-127538848 TAGAACTATCACTTAAAAGTTGG No data
1090526085_1090526090 6 Left 1090526085 11:127538797-127538819 CCTGGTTCCCAACTCCTTGCCTC No data
Right 1090526090 11:127538826-127538848 TAGAACTATCACTTAAAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090526090 Original CRISPR TAGAACTATCACTTAAAAGT TGG Intergenic
No off target data available for this crispr