ID: 1090527201

View in Genome Browser
Species Human (GRCh38)
Location 11:127549597-127549619
Sequence CTAGTTTTCCACATTTTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090527201 Original CRISPR CTAGTTTTCCACATTTTTAT TGG (reversed) Intergenic