ID: 1090528429

View in Genome Browser
Species Human (GRCh38)
Location 11:127562733-127562755
Sequence CTCTAGTTCCTTAAGCAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090528429_1090528430 4 Left 1090528429 11:127562733-127562755 CCTTCTTGCTTAAGGAACTAGAG No data
Right 1090528430 11:127562760-127562782 ATTTCCAATATTTGCAATCAAGG No data
1090528429_1090528431 5 Left 1090528429 11:127562733-127562755 CCTTCTTGCTTAAGGAACTAGAG No data
Right 1090528431 11:127562761-127562783 TTTCCAATATTTGCAATCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090528429 Original CRISPR CTCTAGTTCCTTAAGCAAGA AGG (reversed) Intergenic
No off target data available for this crispr