ID: 1090533047

View in Genome Browser
Species Human (GRCh38)
Location 11:127611162-127611184
Sequence CAAATCCCTGGATGATCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090533047_1090533051 11 Left 1090533047 11:127611162-127611184 CCCAAGGATCATCCAGGGATTTG No data
Right 1090533051 11:127611196-127611218 TACAGAGCTGAGCCAGCTACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090533047 Original CRISPR CAAATCCCTGGATGATCCTT GGG (reversed) Intergenic
No off target data available for this crispr