ID: 1090538342

View in Genome Browser
Species Human (GRCh38)
Location 11:127671590-127671612
Sequence CTAGGTTTGTTCATTATTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090538342_1090538346 18 Left 1090538342 11:127671590-127671612 CCAGTAATAATGAACAAACCTAG No data
Right 1090538346 11:127671631-127671653 GAATACCTTTCTCCAATAAAAGG No data
1090538342_1090538348 24 Left 1090538342 11:127671590-127671612 CCAGTAATAATGAACAAACCTAG No data
Right 1090538348 11:127671637-127671659 CTTTCTCCAATAAAAGGAACAGG No data
1090538342_1090538349 25 Left 1090538342 11:127671590-127671612 CCAGTAATAATGAACAAACCTAG No data
Right 1090538349 11:127671638-127671660 TTTCTCCAATAAAAGGAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090538342 Original CRISPR CTAGGTTTGTTCATTATTAC TGG (reversed) Intergenic