ID: 1090548585

View in Genome Browser
Species Human (GRCh38)
Location 11:127792944-127792966
Sequence CTGGACGAATGGTGTGGAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090548576_1090548585 30 Left 1090548576 11:127792891-127792913 CCAAGTTGCAGAAGCTTTTTGGG No data
Right 1090548585 11:127792944-127792966 CTGGACGAATGGTGTGGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090548585 Original CRISPR CTGGACGAATGGTGTGGAAT GGG Intergenic
No off target data available for this crispr