ID: 1090556704

View in Genome Browser
Species Human (GRCh38)
Location 11:127884035-127884057
Sequence CTATATGCAAAGCTGAAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090556704_1090556708 30 Left 1090556704 11:127884035-127884057 CCAGGCTTCAGCTTTGCATATAG No data
Right 1090556708 11:127884088-127884110 CTTATATTTAATATTTCCCTGGG No data
1090556704_1090556706 7 Left 1090556704 11:127884035-127884057 CCAGGCTTCAGCTTTGCATATAG No data
Right 1090556706 11:127884065-127884087 AGAAACTGTGGAACTCTATAAGG No data
1090556704_1090556705 -5 Left 1090556704 11:127884035-127884057 CCAGGCTTCAGCTTTGCATATAG No data
Right 1090556705 11:127884053-127884075 TATAGAAACTGTAGAAACTGTGG No data
1090556704_1090556707 29 Left 1090556704 11:127884035-127884057 CCAGGCTTCAGCTTTGCATATAG No data
Right 1090556707 11:127884087-127884109 GCTTATATTTAATATTTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090556704 Original CRISPR CTATATGCAAAGCTGAAGCC TGG (reversed) Intergenic
No off target data available for this crispr