ID: 1090563658

View in Genome Browser
Species Human (GRCh38)
Location 11:127962505-127962527
Sequence CTGTTCCAAAGTTGGATTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090563655_1090563658 20 Left 1090563655 11:127962462-127962484 CCACTCTTTAACTGACATGCCAT No data
Right 1090563658 11:127962505-127962527 CTGTTCCAAAGTTGGATTTATGG No data
1090563656_1090563658 1 Left 1090563656 11:127962481-127962503 CCATGAAGTACACAGACAACAAA No data
Right 1090563658 11:127962505-127962527 CTGTTCCAAAGTTGGATTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090563658 Original CRISPR CTGTTCCAAAGTTGGATTTA TGG Intergenic
No off target data available for this crispr