ID: 1090575604

View in Genome Browser
Species Human (GRCh38)
Location 11:128099548-128099570
Sequence TTCCAAGGCTGGCTACTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090575604_1090575613 21 Left 1090575604 11:128099548-128099570 CCTGTTAGTAGCCAGCCTTGGAA No data
Right 1090575613 11:128099592-128099614 CATGGTCATCTATGGGAAGTGGG No data
1090575604_1090575612 20 Left 1090575604 11:128099548-128099570 CCTGTTAGTAGCCAGCCTTGGAA No data
Right 1090575612 11:128099591-128099613 CCATGGTCATCTATGGGAAGTGG No data
1090575604_1090575609 14 Left 1090575604 11:128099548-128099570 CCTGTTAGTAGCCAGCCTTGGAA No data
Right 1090575609 11:128099585-128099607 AATCTCCCATGGTCATCTATGGG No data
1090575604_1090575608 13 Left 1090575604 11:128099548-128099570 CCTGTTAGTAGCCAGCCTTGGAA No data
Right 1090575608 11:128099584-128099606 TAATCTCCCATGGTCATCTATGG No data
1090575604_1090575607 3 Left 1090575604 11:128099548-128099570 CCTGTTAGTAGCCAGCCTTGGAA No data
Right 1090575607 11:128099574-128099596 TCTCATTTTTTAATCTCCCATGG No data
1090575604_1090575614 22 Left 1090575604 11:128099548-128099570 CCTGTTAGTAGCCAGCCTTGGAA No data
Right 1090575614 11:128099593-128099615 ATGGTCATCTATGGGAAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090575604 Original CRISPR TTCCAAGGCTGGCTACTAAC AGG (reversed) Intergenic
No off target data available for this crispr