ID: 1090575606

View in Genome Browser
Species Human (GRCh38)
Location 11:128099563-128099585
Sequence TAAAAAATGAGACATTTCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090575606_1090575613 6 Left 1090575606 11:128099563-128099585 CCTTGGAAATGTCTCATTTTTTA No data
Right 1090575613 11:128099592-128099614 CATGGTCATCTATGGGAAGTGGG No data
1090575606_1090575614 7 Left 1090575606 11:128099563-128099585 CCTTGGAAATGTCTCATTTTTTA No data
Right 1090575614 11:128099593-128099615 ATGGTCATCTATGGGAAGTGGGG No data
1090575606_1090575609 -1 Left 1090575606 11:128099563-128099585 CCTTGGAAATGTCTCATTTTTTA No data
Right 1090575609 11:128099585-128099607 AATCTCCCATGGTCATCTATGGG No data
1090575606_1090575608 -2 Left 1090575606 11:128099563-128099585 CCTTGGAAATGTCTCATTTTTTA No data
Right 1090575608 11:128099584-128099606 TAATCTCCCATGGTCATCTATGG No data
1090575606_1090575612 5 Left 1090575606 11:128099563-128099585 CCTTGGAAATGTCTCATTTTTTA No data
Right 1090575612 11:128099591-128099613 CCATGGTCATCTATGGGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090575606 Original CRISPR TAAAAAATGAGACATTTCCA AGG (reversed) Intergenic
No off target data available for this crispr